RegulonDB RegulonDB 10.9: Gene Sequence
galU gene sequence


Size: 909        A: 250  T: 232  G: 246  C: 181

Fasta

 

>galU E. coli K12. Version NC_000913.3 GI:556503834
atggctgccattaatacgaaagtcaaaaaagccgttatccccgttgcgggattaggaacc
aggatgttgccggcgacgaaagccatcccgaaagagatgctgccacttgtcgataagcca
ttaattcaatacgtcgtgaatgaatgtattgcggctggcattactgaaattgtgctggtt
acacactcatctaaaaactctattgaaaaccactttgataccagttttgaactggaagca
atgctggaaaaacgtgtaaaacgtcaactgcttgatgaagtgcagtctatttgtccaccg
cacgtgactattatgcaagttcgtcagggtctggcgaaaggcctgggacacgcggtattg
tgtgctcacccggtagtgggtgatgaaccggtagctgttattttgcctgatgttattctg
gatgaatatgaatccgatttgtcacaggataacctggcagagatgatccgccgctttgat
gaaacgggtcatagccagatcatggttgaaccggttgctgatgtgaccgcatatggcgtt
gtggattgcaaaggcgttgaattagcgccgggtgaaagcgtaccgatggttggtgtggta
gaaaaaccgaaagcggatgttgcgccgtctaatctcgctattgtgggtcgttacgtactt
agcgcggatatttggccgttgctggcaaaaacccctccgggagctggtgatgaaattcag
ctcaccgacgcaattgatatgctgatcgaaaaagaaacggtggaagcctatcatatgaaa
gggaagagccatgactgcggtaataaattaggttacatgcaggccttcgttgaatacggt
attcgtcataacacccttggcacggaatttaaagcctggcttgaagaagagatgggcatt
aagaagtaa
              
                            

Download fasta file
RegulonDB