RegulonDB RegulonDB 10.9: Gene Sequence
fdx gene sequence


Size: 336        A: 85  T: 77  G: 88  C: 86

Fasta

 

>fdx E. coli K12. Version NC_000913.3 GI:556503834
atgccaaagattgttattttgcctcatcaggatctctgccctgatggcgctgttctggaa
gctaatagcggtgaaaccattctcgacgcagctctgcgtaacggtatcgagattgaacac
gcctgtgaaaaatcctgtgcttgcaccacctgccactgcatcgttcgtgaaggttttgac
tcactgccggaaagctcagagcaggaagacgacatgctggacaaagcctggggactggag
ccggaaagccgtttaagctgccaggcgcgcgttaccgacgaagatttagtagtcgaaatc
ccgcgttacactatcaaccatgcgcgtgagcattaa
              
                            

Download fasta file
RegulonDB