RegulonDB RegulonDB 10.9: Gene Sequence
upp gene sequence


Size: 627        A: 168  T: 127  G: 178  C: 154

Fasta

 

>upp E. coli K12. Version NC_000913.3 GI:556503834
atgaagatcgtggaagtcaaacacccactcgtcaaacacaagctgggactgatgcgtgag
caagatatcagcaccaagcgctttcgcgaactcgcttccgaagtgggtagcctgctgact
tacgaagcgaccgccgacctcgaaacggaaaaagtaactatcgaaggctggaacggcccg
gtagaaatcgaccagatcaaaggtaagaaaattaccgttgtgccaattctgcgtgcgggt
cttggtatgatggacggtgtgctggaaaacgttccgagcgcgcgcatcagcgttgtcggt
atgtaccgtaatgaagaaacgctggagccggtaccgtacttccagaaactggtttctaac
atcgatgagcgtatggcgctgatcgttgacccaatgctggcaaccggtggttccgttatc
gcgaccatcgacctgctgaaaaaagcgggctgcagcagcatcaaagttctggtgctggta
gctgcgccagaaggtatcgctgcgctggaaaaagcgcacccggacgtcgaactgtatacc
gcatcgattgatcagggactgaacgagcacggatacattattccgggcctcggcgatgcc
ggtgacaaaatctttggtacgaaataa
              
                            

Download fasta file
RegulonDB