RegulonDB RegulonDB 10.9: Gene Sequence
nadR gene sequence


Size: 1233        A: 313  T: 292  G: 343  C: 285

Fasta

 

>nadR E. coli K12. Version NC_000913.3 GI:556503834
atgtcgtcatttgattacctgaaaactgccatcaagcaacagggctgcacgctacagcag
gtagctgatgccagcggtatgaccaaagggtatttaagccagttactgaatgccaaaatc
aaaagccccagcgcgcaaaagctggaggcgttgcaccgttttttggggcttgagtttccc
cggcagaagaaaacgatcggtgtcgtattcggtaagttctacccactgcataccggacat
atctaccttatccagcgcgcctgtagccaggttgacgagctgcatatcattatgggtttt
gacgatacccgtgaccgcgcgttgttcgaagacagtgccatgtcgcagcagccgaccgtg
ccggatcgtctgcgttggttattgcaaacttttaaatatcagaaaaatattcgcattcat
gctttcaacgaagagggcatggagccgtatccgcacggctgggatgtgtggagcaacggc
atcaaaaagtttatggctgaaaaagggatccagccggatctgatctacacctcggaagaa
gccgatgcgccacagtatatggaacatctggggatcgagacggtgctggtcgatccgaaa
cgtacctttatgagtatcagcggtgcgcagatccgcgaaaacccgttccgctactgggaa
tatattcctaccgaagtgaagccgttttttgtgcgtaccgtggcgatccttggcggcgag
tcgagcggtaaatccaccctggtaaacaaacttgccaatatcttcaacaccaccagtgcg
tgggaatatggccgcgattatgtcttttcacacctcggcggtgatgagatcgcattgcag
tattctgactacgataaaatcgcgctgggccacgctcaatacattgattttgcggtgaaa
tatgccaataaagtggcatttatcgataccgattttgtcaccactcaggcgttctgcaaa
aagtacgaagggcgggaacatccgttcgtgcaggcgctgattgatgaataccgtttcgat
ctggtgatcctgctggagaacaacacgccgtgggtggcggatggtttacgcagcctcggc
agttcggtggatcgcaaagagttccagaacttgctggtggagatgctcgaagagaacaat
atcgaatttgtgcgggttgaagaggaagattacgacagtcgtttcctgcgctgcgtggaa
ctggtgcgggagatgatgggggagcagagataa
              
                            

Download fasta file
RegulonDB