RegulonDB RegulonDB 10.9: Gene Sequence
ychE gene sequence


Size: 648        A: 137  T: 201  G: 172  C: 138

Fasta

 

>ychE E. coli K12. Version NC_000913.3 GI:556503834
gtgattcagaccttttttgattttcccgtttacttcaaatttttcatcgggttatttgcg
ctggtcaacccggtagggattattcccgtctttatcagcatgaccagttatcagacagcg
gcagcgcgaaacaaaactaaccttacagccaacctgtctgtggccattatcttgtggatc
tcgctttttctcggcgacacgattctacaactttttggtatatcaattgattcgttccgt
atcgccgggggtatcctggtggtgacaatagcgatgtcgatgatcagcggcaagcttggc
gaggataaacagaacaagcaagaaaaatcagaaaccgcggtacgtgaaagcattggtgtg
gtgccactggcgttgccgttgatggcggggccaggggcgatcagttctaccatcgtctgg
ggtacgcgttatcacagcattagctatctgtttggtttctttgtggctattgcattgttc
gctttatgttgttggggattgttccgcatggcaccgtggctggtacgggttttacgccag
accggcatcaacgtgattacgcgtattatggggctattgctgatggcattggggattgaa
tttatcgttactggtattaaggggattttccccggcctgcttaattaa
              
                            

Download fasta file
RegulonDB