RegulonDB RegulonDB 10.9: Gene Sequence
fliF gene sequence


Size: 1659        A: 415  T: 338  G: 471  C: 435

Fasta

 

>fliF E. coli K12. Version NC_000913.3 GI:556503834
atgaatgcgactgcagcccagacaaaatctcttgagtggcttaatcgcctgcgtgcgaat
ccgaaaattccattgattgttgccggttccgcggcagtggcggtcatggtcgcactgatc
ctgtgggcgaaagcccccgactaccgcacattattcagcaatctttccgatcaggatggt
ggcgcaattgtcagccaactgacgcaaatgaatattccttaccgcttcagcgaagccagc
ggcgctattgaagttccggcagataaagttcacgaactgcgtctgcgcctggcacaacaa
ggtttgccaaaaggcggcgcggtcggtttcgaactgcttgatcaggaaaagtttggtatc
agccagttcagcgaacaggtgaattatcagcgggcgctggaaggcgagctttctcgtacc
atcgaaactatcggcccggtaaaaggggcgcgcgtacatctggcaatgccgaaaccgtct
ttattcgtccgtgaacaaaaatccccttctgcatcggtgacggtaaatctgttacccggc
cgcgcactcgatgaagggcaaattagcgccattgtgcatctggtttccagcgccgttgct
ggtctgccgccgggaaacgtcacgctggtggatcagggcggacatctgttaacccagtcc
aataccagcgggcgcgatcttaatgacgctcagttgaaatatgccagcgatgtcgaaggc
cgtattcagcggcgtattgaagcgatcctgtcgcctattgttggtaacggtaatattcac
gcccaggttacggcgcagctggacttcgccagtaaagaacaaacggaagaacagtatcgc
cctaacggtgatgaatctcatgcggcgcttcgttcacgccagcttaatgagagcgagcaa
agcggttccggttatccgggcggcgtaccgggggcgttgtcgaatcaaccggcacctgcg
aataacgcgccaatcagcacgcctccggcaaatcaaaataaccgccagcagcaggcgagc
accaccagcaatagtgggccgcgtagcacacagcggaatgaaaccagtaactacgaagtc
gatcgcaccattcgtcataccaaaatgaacgtgggcgatgtgcaacgtctgtcagtcgcg
gtcgtggtgaattacaaaaccttgccagatggcaaaccgttgcctctcagcaacgaacag
atgaagcaaattgaagatctgacccgcgaggcgatgggcttttctgaaaaacgcggtgac
tcgctcaatgtcgttaactcgccgttcaatagcagtgacgaaagcggcggagaactgcca
ttctggcaacagcaagcgtttatcgatcagttacttgctgccggtcgctggttgctggta
ctgctggtggcgtggctgctgtggcggaaagcggtacgtccgcagctaacacgtcgcgct
gaggcgatgaaagctgtacagcaacaggcgcaggcccgcgaggaagtggaagatgcggtg
gaagtccgcctgagcaaagacgaacaactacaacaacggcgcgctaaccaacgtctgggg
gcagaagtcatgagccagcgtatccgtgaaatgtctgataacgatccgcgcgtggtggcg
ctggtcattcgccagtggataaataacgatcatgagtaa
              
                            

Download fasta file
RegulonDB