RegulonDB RegulonDB 10.9: Gene Sequence
waaS gene sequence


Size: 936        A: 378  T: 307  G: 147  C: 104

Fasta

 

>waaS E. coli K12. Version NC_000913.3 GI:556503834
atgactatttattttataaattgggttgcagattatgaattaaaaatgattcagtacctg
aaaaaaaagtacaagataaaaaatataacaacaccaaaaaaatataactggattaataaa
aaaatatcaaaaatagggatggataatgcatggctggggcgattattcatcaagcattac
ctcaatgatattaaaaaagatgacataattatcattaatgacagtgttgttaataaaggt
atcaataaacaaatattaaaaaatattaactgtcataaagttttgcttctaagaaatact
gttggcgaagattttattcttgataacgcgaattatttcgatattatatatgattttgag
catagatttatagggaatgaaaagatcaaggcaatagaacaattttttcctataggaatg
gatgaaattagaaattatagtttatctgacaaaaataacagccagccaatatgttttttc
cttggtcgtgataaagggcgtcttcaaataattaatgagttagccgagagattaacaaca
ctaggatgtaagctagattttaatgttgtcaaagataagacatcatctacgacttcaaag
tatttgattgaaaaacaaatatcttatgaagagaatattagaagaacattaaatgctaat
ataattgttgatataaccaaagaaaaccaatctggctggactcttcgtatacttgaggca
ctatttttcaataaaaaattaattactaataatataaatgtatttggttcagaaatctat
agtgaatctcgcttttttataataggtcatgatgattgggataagttagagtattttatt
aactcatctgttaaaccaatggattatgatagtttatataaattcagtccagataaaatg
atgtcaacgattgtttctgattttatagacaaataa
              
                            

Download fasta file
RegulonDB