RegulonDB RegulonDB 11.0: Gene Sequence
emrA gene sequence


Size: 1173        A: 306  T: 241  G: 313  C: 313

Fasta

 

>emrA E. coli K12. Version NC_000913.3 GI:556503834
atgagcgcaaatgcggagactcaaaccccgcagcaaccggtaaagaagagcggcaaacgt
aagcgtctgctcctccttctcaccttgctctttataattattgccgtagcgatagggatt
tattggtttttggtactgcgtcacttcgaagaaaccgatgacgcatacgtggcagggaat
caaattcaaattatgtctcaggtgtctggcagcgtgacgaaagtctgggccgataacacc
gattttgtaaaagaaggcgacgtgctggtcactctcgacccgacagatgctcgccaggcg
tttgaaaaagccaaaactgcactggcttccagcgttcgccaaacccaccagctgatgatt
aacagcaagcagttgcaggcgaatattgaggtgcagaaaatcgccctcgcgaaagcacaa
agcgactacaaccgccgtgtgccgctgggcaatgccaacctgattggtcgcgaagagctg
caacacgcccgcgacgccgtcaccagtgcccaggcgcaactggacgtcgcgattcaacaa
tacaatgccaatcaggcgatgattctggggactaaactggaagatcagccagccgtgcaa
caggctgccaccgaagtacgtaacgcctggctggcgctggagcgtactcgtattatcagt
ccgatgaccggttatgtctcccgccgcgcggtacagcctggggcgcaaattagcccaacg
acgccgctgatggcggtcgttccagccaccaatatgtgggtggatgccaactttaaagag
acgcagattgccaatatgcgtatcggtcagccggtcactatcaccacggatatttacggc
gatgatgtgaaatacaccggtaaagtggttggtctggatatgggcacaggtagcgcgttc
tcactgcttccagcgcaaaatgcgaccggtaactggatcaaagtcgttcagcgtctgcct
gtgcgtatcgaactggaccagaaacagctggagcaatatccgctgcgtatcggtttgtcc
acgctggtgagcgtcaataccactaaccgtgacggtcaggtactggcaaataaagtacgt
tccactccggtagcggtaagcaccgcgcgtgaaatcagcctggcacctgtcaataaactg
atcgacgatatcgtaaaagctaacgctggctaa
              
                            

Download fasta file
RegulonDB