RegulonDB RegulonDB 11.0: Gene Sequence
fliA gene sequence


Size: 720        A: 185  T: 145  G: 211  C: 179

Fasta

 

>fliA E. coli K12. Version NC_000913.3 GI:556503834
gtgaattcactctataccgctgaaggtgtaatggataaacactcgctgtggcagcgttat
gtcccgctggtgcgtcacgaagcattgcgcctgcaggttcgactgcccgcgagcgtggaa
cttgacgatctgctacaggcgggcggcattgggttacttaatgccgtcgaacgctatgac
gccctacaaggaacggcatttacaacttacgcagtgcagcgtatccgtggcgctatgctg
gatgaacttcgcagccgtgactgggtgccgcgcagcgtgcgacgcaacgcgcgtgaagtg
gcacaggcaatagggcaactggagcaggaacttggccgcaacgccacggaaactgaggta
gcggaacgtttagggatcgatattgccgattatcgccaaatgttgctcgacaccaataac
agccagctcttctcctacgatgagtggcgcgaagagcacggcgatagcatcgaactggtt
actgatgatcatcagcgagaaaacccgctacaacaactactggacagtaatctgcgccag
cgggtgatggaagccatcgaaacgttgccggagcgcgaaaaactggtattaaccctctat
taccaggaagagctgaatctcaaagagattggcgcggtgctggaggtcggggaatcgcgg
gtcagtcagttacacagccaggctattaaacggttacgcactaaactgggtaagttataa
              
                            

Download fasta file
RegulonDB