RegulonDB RegulonDB 10.9: Gene Sequence
fliZ gene sequence


Size: 552        A: 153  T: 142  G: 119  C: 138

Fasta

 

>fliZ E. coli K12. Version NC_000913.3 GI:556503834
atgatggtgcagcacctgaaaagacggccattaagccgctatcttaaagactttaaacac
agccagacccattgcgcgcattgccgtaaattactcgatcgcattaccttagttcgcgac
ggcaaaatagtgaataaaatcgagatttcccgcctggacacgctgcttgatgaaaatggc
tggcaaacggaacaaaaatcatgggcggcattgtgccgattttgcggtgatttacattgc
aaaacgcagagtgattttttcgatattatcggctttaagcaatttctttttgagcaaact
gaaatgagcccaggtacggtgcgtgaatatgtcgttcgtttgcgccgtttggggaatcat
ctacacgagcaaaatatttccctcgatcagctgcaggacggtttccttgatgaaatcctc
gccccgtggctgcccaccaccagcaccaacaattaccgcatcgcgttacggaagtatcaa
cactatcagcgccaaacctgtaccagacttgtgcagaaatcctccagcctgccttcttct
gatatatattaa
              
                            

Download fasta file
RegulonDB