RegulonDB RegulonDB 10.10: Gene Sequence
murA gene sequence


Size: 1260        A: 298  T: 290  G: 367  C: 305

Fasta

 

>murA E. coli K12. Version NC_000913.3 GI:556503834
atggataaatttcgtgttcaggggccaacgaagctccagggcgaagtcacaatttccggc
gctaaaaatgctgctctgcctatcctttttgccgcactactggcggaagaaccggtagag
atccagaacgtcccgaaactgaaagacgtcgatacatcaatgaagctgctaagccagctg
ggtgcgaaagtagaacgtaatggttctgtgcatattgatgcccgcgacgttaatgtattc
tgcgcaccttacgatctggttaaaaccatgcgtgcttctatctgggcgctggggccgctg
gtagcgcgctttggtcaggggcaagtttcactacctggcggttgtacgatcggtgcgcgt
ccggttgatctacacatttctggcctcgaacaattaggcgcgaccatcaaactggaagaa
ggttacgttaaagcttccgtcgatggtcgtttgaaaggtgcacatatcgtgatggataaa
gtcagcgttggcgcaacggtgaccatcatgtgtgctgcaaccctggcggaaggcaccacg
attattgaaaacgcagcgcgtgaaccggaaatcgtcgataccgcgaacttcctgattacg
ctgggtgcgaaaattagcggtcagggcaccgatcgtatcgtcatcgaaggtgtggaacgt
ttaggcggcggtgtctatcgcgttctgccggatcgtatcgaaaccggtactttcctggtg
gcggcggcgatttctcgcggcaaaattatctgccgtaacgcgcagccagatactctcgac
gccgtgctggcgaaactgcgtgacgctggagcggacatcgaagtcggcgaagactggatt
agcctggatatgcatggcaaacgtccgaaggctgttaacgtacgtaccgcgccgcatccg
gcattcccgaccgatatgcaggcccagttcacgctgttgaacctggtggcagaagggacc
gggtttatcaccgaaacggtctttgaaaaccgctttatgcatgtgccagagctgagccgt
atgggcgcgcacgccgaaatcgaaagcaataccgttatttgtcacggtgttgaaaaactt
tctggcgcacaggttatggcaaccgatctgcgtgcatcagcaagcctggtgctggctggc
tgtattgcggaagggacgacggtggttgatcgtatttatcacatcgatcgtggctacgaa
cgcattgaagacaaactgcgcgctttaggtgcaaatattgagcgtgtgaaaggcgaataa
              
                            

Download fasta file
RegulonDB