RegulonDB RegulonDB 10.8: Gene Sequence
gluQ gene sequence


Size: 927        A: 209  T: 221  G: 238  C: 259

Fasta

 

>gluQ E. coli K12. Version NC_000913.3 GI:556503834
atgctcccgccttattttttgttcaaagagatgacagacacacagtatattggccgcttc
gccccctctccttccggcgagcttcattttggctctctgatcgccgcgctcggcagctat
ttgcaggctcgcgcccggcaaggtcgctggctggtacgcatagaagatatcgacccgcct
cgtgaagttcccggtgccgcagaaactatcctgcgccagctggaacattacggtctgcac
tgggacggcgatgttctctggcaatcgcaacgtcacgacgcctatcgtgaagcactcgcc
tggttacatgaacaaggactaagttattactgcacctgtacgcgtgcgcgtattcaaagc
attggcggtatttacgacggtcattgccgggtgttgcatcatggaccagacaacgccgca
gtgcgtatccgccagcagcatccggtcacgcaatttactgaccagctgcgcggcattatt
cacgccgacgaaaaactggcacgggaagattttatcattcatcgccgtgatgggttgttc
gcctacaacctggctgttgtggttgatgatcatttccagggcgttacagaaatagtgcgt
ggggctgatctgattgaaccaacagtaaggcaaatctcgctgtaccagctttttggctgg
aaagtgccagattacattcatctgccgctggcgcttaatccacaaggcgctaaactttcc
aagcagaatcatgcgcctgcgttgccgaaaggcgatccacgcccggtactaatcgcggca
cttcaatttctggggcagcaggcagaagcacactggcaggatttcagcgtcgagcaaatc
cttcagtcagccgtcaaaaactggcggcttaccgccgtgcccgagtcggcaattgtaaat
tcaacattctcaaatgcgtcatgctga
              
                            

Download fasta file
RegulonDB