RegulonDB RegulonDB 10.9: Gene Sequence
amiB gene sequence


Size: 1338        A: 318  T: 283  G: 381  C: 356

Fasta

 

>amiB E. coli K12. Version NC_000913.3 GI:556503834
atgatgtatcgcatcagaaattggttggtagcgacgctgctgctgctgtgcacgccggtg
ggtgccgcgacgctctctgatattcaggtttctaacggtaatcaacaggcgcggataacg
ttgagttttattggcgatcctgattatgcgtttagccatcaaagcaaacgcaccgtggcg
ctcgatatcaaacaaacgggcgtgattcagggactgccgttgttgttcagcggcaataat
ctggtgaaggcgattcgctctggaacgcctaaagatgcacaaacgctacggctggtggtc
gatcttaccgaaaacggtaaaaccgaagcggtgaagcggcagaatggcagcaattacact
gtcgtctttacgattaacgccgatgtgccgccaccgcctcctccgccgcccgtggttgcg
aaacgcgttgaaacgcctgcggttgtcgcaccgcgcgtcagcgaaccggcgcgcaatccg
tttaaaacggaaagtaaccgcactacgggtgttatcagcagtaatacggtaacgcgtccg
gcagcgcgcgcgacggctaacactggcgataaaattatcatcgctattgatgccggacac
ggcggtcaggaccctggcgctatcggccccggtggtacgcgggagaaaaatgtcaccatc
gccatcgcgcgtaaattgcgtactttgctcaatgacgatccgatgtttaaaggcgtttta
acccgtgacggggattactttatctcggtgatggggcgcagtgatgtggcacgtaagcaa
aacgccaatttcctcgtgtcgattcacgctgatgccgcaccgaaccgcagtgcgactggc
gcttccgtatgggtgctctctaaccgtcgcgccaacagtgaaatggccagctggctggag
cagcacgagaaacagtcggagctgctgggtggggcgggtgatgtgctggcgaacagtcag
tctgacccctatttaagccaggcggtgctggatttacagttcggtcattcccagcgggta
gggtatgatgtagcgaccagtatgatcagtcagttgcaacgcattggcgaaatacataaa
cgtcgaccagaacacgccagccttggcgttctgcgctcgccggatatcccatcagtactg
gtcgaaaccggttttatcagcaacaacagcgaagaacgtttgctggcgagcgacgattac
caacaacagctggcagaagccatttacaaaggcctgcgcaattacttccttgcgcatccg
atgcaatctgcgccgcagggtgcaacggcacaaactgccagtacggtgacgacgccagat
cgcacgctgccaaactaa
              
                            

Download fasta file
RegulonDB