RegulonDB RegulonDB 10.9: Gene Sequence
rob gene sequence


Size: 870        A: 198  T: 209  G: 230  C: 233

Fasta

 

>rob E. coli K12. Version NC_000913.3 GI:556503834
atggatcaggccggcattattcgcgaccttttaatctggctggaaggtcatctggatcag
cccctgtcgctcgacaatgtagcggcgaaagcaggttattccaagtggcacttacagaga
atgtttaaagatgtcactggccatgctattggcgcgtatattcgtgctcgtcgtttgtcg
aaatcggcggtcgcactacgcctgactgcgcgtccgattctggacatcgcgctgcaatac
cgcttcgactctcaacagacatttacccgcgcattcaagaagcagtttgcccagactcct
gcactttaccgccgttctcctgaatggagcgcctttggtattcgcccgccgctacgcctg
ggtgaattcactatgccagagcacaaatttgtcaccctggaagatacgccgctgattggt
gttacccagagctactcctgttcgctggagcaaatctctgatttccgccatgaaatgcgt
tatcagttctggcacgattttctcggcaacgcgccgaccattccgccggtgctctacggc
ctgaatgaaacgcgtccgagtcaggataaagacgacgagcaagaggtattctataccacc
gcgttagcccaggatcaggcagatggctatgtactgacggggcatccggtgatgctgcag
ggcggcgaatatgtgatgtttacctatgaaggtctgggaaccggcgtgcaggagtttatc
ctgacggtatacggaacgtgcatgccaatgctcaacctgacgcgccgtaaaggtcaggat
attgagcgatactacccggcagaagatgccaaagcgggagatcgcccaattaatctacgc
tgtgaactgctgattccgatccgtcgttaa
              
                            

Download fasta file
RegulonDB