RegulonDB RegulonDB 10.9: Gene Sequence
menB gene sequence


Size: 858        A: 203  T: 178  G: 251  C: 226

Fasta

 

>menB E. coli K12. Version NC_000913.3 GI:556503834
atgatttatcctgatgaagcaatgctttacgcaccggttgaatggcacgactgctccgaa
ggtttcgaggacattcgttatgaaaaatccaccgacggtatcgcaaaaatcaccattaat
cgtccgcaggtgcgcaatgccttccgtcctctgacggtaaaagagatgatccaggcgctg
gcagatgcgcgttatgacgacaacatcggcgtgatcattctgactggtgcaggcgataaa
gcgttctgctccggtggtgaccagaaagtgcgtggtgattacggcggctataaagatgat
tccggcgtacatcacctgaatgtgctggacttccagcgtcagatccgtacctgtccgaaa
ccggttgtcgcgatggtggctggctactccatcggcggcggtcacgttctgcacatgatg
tgcgacctgactatcgcggcagataatgccatcttcggtcagactggcccgaaagtcggt
tccttcgacggcggctggggcgcttcctacatggctcgcatcgtcgggcagaaaaaagcg
cgtgaaatctggttcctgtgccgtcagtacgacgcaaaacaggcgctggatatgggcctt
gtgaacaccgtggtaccgctggcggatctggaaaaagaaaccgtccgttggtgccgcgaa
atgctgcaaaacagcccgatggcgctgcgctgcctgaaagctgcactgaacgccgactgt
gacgggcaggcggggctgcaggagctggcgggcaacgccaccatgctgttctacatgacg
gaagaaggtcaggaaggtcgcaacgccttcaaccagaaacgtcagcctgacttcagcaaa
ttcaaacggaatccgtaa
              
                            

Download fasta file
RegulonDB