RegulonDB RegulonDB 10.10: Gene Sequence
ubiA gene sequence


Size: 873        A: 170  T: 251  G: 267  C: 185

Fasta

 

>ubiA E. coli K12. Version NC_000913.3 GI:556503834
atggagtggagtctgacgcagaataagctgctggcgtttcatcgcttaatgcgtacggat
aagccaattggcgcgttactgctgctctggccaacattatgggcgttgtgggtggcgaca
ccgggcgttccccagctctggatcctggcggtgtttgtcgcgggtgtctggctgatgcgc
gctgccggatgtgtggtgaatgattatgctgaccgcaagtttgatggtcatgttaagcgc
acggcgaaccgaccacttcccagcggcgcggtaacagagaaagaggcgcgcgcgctgttt
gtcgtgctggtactgatttcgtttttactggtgctgacgctgaatacgatgaccattctg
ttgtcgattgccgcgctagcgctggcgtgggtgtacccgtttatgaagcggtatacccat
ctaccgcaagtggtgctgggcgcggcgtttggctggtcgattccaatggcttttgccgct
gtgagtgagtcggtgccattgagttgctggttaatgttcctcgccaatattctctgggcg
gtggcttacgacacgcagtatgcgatggttgaccgcgatgatgatgtgaagattggcatt
aaatccacggcaatcctgttcggccaatacgataaattgattattggtattttgcagatt
ggcgtactggcactgatggcgatcatcggtgagttaaatggcttaggctggggatattac
tggtcaattctggtggctggcgcgctgtttgtttatcaacaaaaactgattgccaaccgc
gagcgtgaagcctgctttaaagcatttatgaataataactatgttggtctggtactattt
ttagggctggcaatgagttactggcatttctga
              
                            

Download fasta file
RegulonDB