RegulonDB RegulonDB 10.9: Gene Sequence
pgpC gene sequence


Size: 636        A: 126  T: 178  G: 177  C: 155

Fasta

 

>pgpC E. coli K12. Version NC_000913.3 GI:556503834
ttggcaactcacgagcgtcgtgtggtgttttttgacttagatggaacattgcatcagcag
gatatgttcggcagttttctgcgctatttactacgtcgccaaccgctgaatgcgttactt
gtcctgccgttgttaccgattatagccattgcgttattgataaaaggtcgtgcggcacgc
tggccgatgagtctgcttctgtgggggtgcacttttggtcacagcgaagcacgtttacag
acgttgcaggccgatttcgtgcgctggtttcgcgacaatgttaccgcctttccgctggtt
caggagcgattaaccacctacctgttaagttccgatgctgatatctggttgattaccggc
tctccgcagccgctggttgaagcggtttatttcgatacgccctggctgccgcgggttaat
cttatcgccagccaaattcagcgtggctatggtggttgggtattgacgatgcgttgtctg
ggacatgaaaaggtcgcacaactggagcgcaaaatcggcactccgctgcggctgtacagt
ggctatagcgacagtaatcaggacaatccgctgctttatttctgtcagcatcgttggcga
gtaaccccgcgcggtgaactccagcaactggaatag
              
                            

Download fasta file
RegulonDB