RegulonDB RegulonDB 10.9: Gene Sequence
folK gene sequence


Size: 480        A: 124  T: 116  G: 118  C: 122

Fasta

 

>folK E. coli K12. Version NC_000913.3 GI:556503834
atgacagtggcgtatattgccataggcagcaatctggcctctccgctggagcaggtcaat
gctgccctgaaagcattaggcgatatccctgaaagccacattcttaccgtttcttcgttt
taccgcaccccaccgctggggccgcaagatcaacccgattacttaaacgcagccgtggcg
ctggaaacctctcttgcacctgaagagctactcaatcacacacagcgtattgaattgcag
caaggtcgcgtccgcaaagctgaacgctggggaccacgcacgctggatctcgacatcatg
ctgtttggtaatgaagtgataaatactgaacgcctgaccgttccgcactacgatatgaag
aatcgtggatttatgctgtggccgctgtttgaaatcgcgccggagttggtgtttcctgat
ggggagatgttgcgtcaaatcttacatacaagagcatttgacaaattaaacaaatggtaa
              
                            

Download fasta file
RegulonDB