RegulonDB RegulonDB 10.9: Gene Sequence
folE gene sequence


Size: 669        A: 173  T: 153  G: 166  C: 177

Fasta

 

>folE E. coli K12. Version NC_000913.3 GI:556503834
atgccatcactcagtaaagaagcggccctggttcatgaagcgttagttgcgcgaggactg
gaaacaccgctgcgcccgcccgtgcatgaaatggataacgaaacgcgcaaaagccttatt
gctggtcatatgaccgaaatcatgcagctgctgaatctcgacctggctgatgacagtttg
atggaaacgccgcatcgcatcgctaaaatgtatgtcgatgaaattttctccggtctggat
tacgccaatttcccgaaaatcaccctcattgaaaacaaaatgaaggtcgatgaaatggtc
accgtgcgcgatatcactctgaccagcacctgtgaacaccattttgttaccatcgatggc
aaagcgacggtggcctatatcccgaaagattcggtgatcggtctgtcaaaaattaaccgc
attgtgcagttctttgcccagcgtccgcaggtgcaggaacgtctgacgcagcaaattctt
attgcgctacaaacgctgctgggcaccaataacgtggctgtctcgatcgacgcggtgcat
tactgcgtgaaggcgcgtggcatccgcgatgcaaccagtgccacgacaacgacctctctt
ggtggattgttcaaatccagtcagaatacgcgccacgagtttctgcgcgctgtgcgtcat
cacaactga
              
                            

Download fasta file
RegulonDB