RegulonDB RegulonDB 10.9: Gene Sequence
appB gene sequence


Size: 1137        A: 194  T: 338  G: 335  C: 270

Fasta

 

>appB E. coli K12. Version NC_000913.3 GI:556503834
atgtttgattatgaaacattgcgcttcatctggtggctgctgattggcgtgatcctggtg
gtctttatgatctccgacggatttgacatggggatcggctgtctgctgccgctggtggcg
cgtaatgatgatgaacgccggatagtgataaacagcgttggtgcacactgggaaggcaac
caggtctggttgatcctcgctggtggggcattatttgccgcctggcccagagtgtatgca
gcggcgttttccggcttttatgtggcgatgatcctggtgctgtgctcactgttcttccgc
ccgctggcctttgattatcgcggaaaaatcgccgatgcacgctggcgtaaaatgtgggac
gccggtctggtcatcggcagtctggtgccgccggtagtcttcggtatcgccttcggcaac
ttgttgctcggcgtgccgtttgccttcacaccgcaattacgcgtggagtatctcggcagc
ttctggcaactgctgacgccattccctttattgtgcggattgctcagccttgggatggtg
attttgcaaggtggcgtctggttacaactgaaaactgttggtgtgattcatctgcgttca
cagctggcgaccaaacgcgctgcactgttggtgatgctgtgctttttgctggcgggttac
tggctgtgggtcggtattgatggctttgtactgctcgcccaggatgctaacggtccttcc
aatccgttaatgaaactggtggcagtgctacctggtgcctggatgaataattttgtcgag
tcgcccgttttgtggatcttcccgctgctgggattcttctgcccattgctgacggtgatg
gcgatttatcgtggtcgcccgggttggggatttttgatggcatcattgatgcaatttggc
gtgattttcacggcaggcatcacgctgttcccctttgtcatgccgtcaagcgtgagtccg
atctccagcctgacgttgtgggacagtacttccagtcagctgacgctgagcattatgttg
gtaatcgtgctgatatttttgcccattgtgttgctctacactctctggagctactacaaa
atgtgggggcgcatgacaacagaaactctccgccgtaacgaaaacgagttgtactaa
              
                            

Download fasta file
RegulonDB