RegulonDB RegulonDB 10.9: Gene Sequence
appC gene sequence


Size: 1545        A: 311  T: 399  G: 438  C: 397

Fasta

 

>appC E. coli K12. Version NC_000913.3 GI:556503834
atgtgggatgtcattgatttatcgcgctggcagtttgctctgaccgcgctgtatcacttt
ttatttgtaccccttaccctggggctgatttttttgctggctattatggaaaccatttac
gtggtcaccggcaaaacaatctaccgcgatatgacgcgcttctggggtaagctcttcggt
atcaattttgctcttggcgtggctaccggcctgaccatggagtttcagtttggtactaac
tggtcattctattccaactatgtgggcgatatttttggcgcaccgctggcgatggaagca
ttaatggccttcttcctcgaatccacctttgtcgggctgttcttcttcggctggcaacgg
ctgaataaataccagcacctgctggtgacgtggctggtggcgttcggttcaaatctctct
gcgttgtggatattgaatgccaacggttggatgcaatacccgaccggtgcgcattttgat
atcgacaccctgcgtatggagatgaccagcttcagcgagctggtctttaatccggtcagc
caggtgaaatttgtgcacaccgtaatggcgggctacgtgaccggggccatgtttattatg
gcgatcagcgcctggtatttactgcgcggacgggagcgcaatgtcgcattacgctcgttt
gccatcggttccgtcttcggtactctggcgattatcggtaccctgcaactcggagacagt
tctgcgtatgaagtcgcgcaagtacaaccggtaaaactggcggcgatggaaggggagtgg
caaacggaacctgcacctgcaccgttccatgtggttgcctggccggaacaggatcaagag
cgtaacgcctttgccctcaaaattcccgcgctgctagggatcctcgccactcactcatta
gataaacccgtgccgggtctgaagaatttgatggctgaaacctacccacgcttgcaacgc
ggacgtatggcctggctgttaatgcaggaaatatcgcaaggcaatcgtgagccgcatgtg
ttgcaggcattccggggactggaaggtgacctgggctacggcatgttgctctcccgctat
gcgccggatatgaatcatgtcacagccgcacagtaccaggcggcgatgcgtggcgcgata
cctcaggttgcgccggtattctggagtttccgcatcatggtgggctgtggttccctgctg
ctactggtgatgctgattgcgcttgtccagacgctgcgtggcaaaatcgaccagcatcgc
tgggtgctgaaaatggcgctctggagtttgccgttgccgtggattgcgattgaagccggg
tggtttatgaccgagtttggtcgtcagccgtgggcgatacaggacatcttaccgacatac
tccgcgcactccgctttaaccacaggacaactggctttctcactgatcatgatcgtaggg
ctttacaccctgttcttaatcgccgaagtctacctgatgcagaaatatgcccgtctgggg
ccgagcgcgatgcagagtgaacaaccgacgcagcaacaggggtaa
              
                            

Download fasta file
RegulonDB