RegulonDB RegulonDB 10.9: Gene Sequence
elbB gene sequence


Size: 654        A: 150  T: 159  G: 202  C: 143

Fasta

 

>elbB E. coli K12. Version NC_000913.3 GI:556503834
atgaagaaaattggcgtaattctgagcggatgcggcgtctatgacggttctgaaattcat
gaagcggtgttgacgttgttagctatttcacgcagcggtgcgcaggcggtctgctttgca
ccggataagcagcaggttgatgttatcaaccatttaactggcgaagcgatgacggaaacg
cgcaatgtgctgattgaagcggcacgaataacgcgcggtgaaatccgtcctctggcccag
gccgatgccgctgaactggatgcgttgattgtgccgggggggtttggcgcggcgaagaat
ttaagcaattttgccagtcttggtagcgaatgcaccgttgaccgtgaattaaaggcgctg
gcacaagcgatgcatcaggccggaaaaccgcttggttttatgtgtattgccccggcgatg
ctgccgaaaattttcgatttcccgctgcgtttgaccatcggtactgatatcgataccgca
gaagtgctggaagagatgggcgcggagcatgtgccgtgtcctgtcgatgatatcgtggtt
gatgaagacaataagattgtcaccaccccagcatatatgctggcgcagaacattgcagaa
gcggcgagcggcattgataagctggtttcccgcgtgctggttctggctgaatga
              
                            

Download fasta file
RegulonDB