RegulonDB RegulonDB 11.0: Gene Sequence
yjiV gene sequence


Size: 2721        A: 736  T: 621  G: 732  C: 632

Fasta

 

>yjiV E. coli K12. Version NC_000913.3 GI:556503834
gtgtatgtgaaccagcgacaaaattgtgactgtggaagccctgtatacgaagttgcattc
tgtaatgattgtaatgagcctcatcttctggcacgggacaaaaagggcaaactagtccag
tgggaaaataaaggtggcgatgaattctctttgcaggatgaagtacctgttgaacatgac
gctacagaagaaaaagtcgaaaaagagaacagttttcagcctccgttgattattgccgca
ggagagaccagcgaggcaggttataccctacaacgcctcgaccgtcagacgcgccgtatt
ggcgttattaacaatgacagcattccgctgattattaatgatattgaacaggtttgtagt
gccagtggctgtggctacagaggcatgagtgggaaacagcccttccggcgtgcactatta
ggtgggccattttacgttactaatatcgtgcccaccgttctagagtattgtcaggacttt
accagtgatgaaggcaaagagggcgtcggaccagattcgttgccaggacgaggtcgtcga
ctcatcacctttacagacagtcgacaagggacagcccgaatggcggtgcgtatgcagcaa
gaagcagaacgcagtcgcttacgcggaagcgtagtcgaaattctcagctggcatcaaagg
acgcaaacgtctacagcgccgaatgccaatgccgatctggaaaaattagcggccagggcg
aagcaagcccgtgagcaggcagaagaatatcgaagctggggaatgccagaccaggcgaaa
ttgtcacaagcacaggctgaacagcttgaacaggcttatcaggctgcaaccggtgggaaa
gccgcgactatcctggtatcccgaacctggacggagatggttaacgagcttaaagagaga
gccgatatccgcgggccggttctgcaatataaccattatcttaagcctgaagtgtttaat
gaaaacggcggcccccttaagctttctgaaatgttgttgttccgggaattcatgcgtcgc
cctaaacggactaacagcctggaaacacaggggctggttcaggttggttaccaggggctg
gagaaaatacataagagccccttgcactggcaggaaaaaggattaacgctggatgactgg
cgcgattttctcaaggttacgttggatcattacgttcgcgagagcaacttcacacagctg
gatgatgagctgaaaaactggattggtagccgtttttcatcaaaattcgtccgtaacccg
gaatcaaaagatcctgaagataatcagaacagacgctggcctcaaattcgtaatggcaac
gtatcccatcgtttagcgaagttgctgatgctgggggctggattcaaaaccgtcaatgcg
gcaactattgatattatcaatacatggctgaaagaagcatgggcccaacttaccggaccg
cttgcagtactgaaacccgatggcaaccgtttttatttaccgaaagagcatatgactttt
tctttaatcacggatgcctggatttgcccggtaaccaataaaatcctggatacggctttt
aaaggcttaaccccttatctgcctacccatatttcgttcgagcatcttaccctggcgcaa
tatgacacttttgtcgcgcagaaagtcacaatgccggaaatctggaagctggatcgttca
caggaagactacgcagagggtctggcaaaagcacgcgactgggtcagccatgatccgctg
atcgcacaattgcggtcggaaaacgtctggacagacattaacgatcgtgtcgtggaaggc
ggcttctactatcgtactgccgagcactctgcccagcagtcgtcagaacgtctgcaaagc
tatgaaaagatgttcaagaatgggcaactaaatgttctcaactgttccaccaccatggaa
atgggggttgataccgatcgcgtgatgacgctggcctctcgcagccagcaggcaacgatt
ccggggccggagtggcacctgaatgacgaactggtggtgcgtagtctcggttataaaacg
gtagaactgaacgagtttattctgccggctaaagccaccaacgctgtcgagcgggtcaaa
gacattcagatccacaaacagttgaatggaccactgtcgcagtttgggcaacgcttctgg
gacgtgctgtttaacgaccatgaagaagcgcagtcactgatgaataacacgcgaattacc
ggcgttcactataccgatcgctatctgcaaaacccggttgcgctggcgttgttgggatca
attctgagaccgctaaaaacaaagctgaccgatggcgctgaagtgacgctggatacgcta
tttaaagataaagatcgccccggtaaccggcctttccatgactggatgagcatagcggat
tttcaggatttcgctgatcagtggtttgctgctgcgctgggcaggccggtagaactgacg
gtgttcgactcgccgcgcgatatccctcaccatcgtaaactgacggtgacttttgaggat
ggtcaggtattgaagatccgcttcgatcaggggatgggctactggcgcatcaacttttca
tcgcaatggcattactttgatttccgcgatgacgtttctttccagttagtcaaaatggct
caggcctgcaaggaagggaatgtcgccaacagcgaagagagttgggcaacggatgtgctg
gtggaggtgatcgcctcctga
              
                            

Download fasta file
RegulonDB