RegulonDB RegulonDB 11.0: Gene Sequence
fliT gene sequence


Size: 366        A: 98  T: 79  G: 101  C: 88

Fasta

 

>fliT E. coli K12. Version NC_000913.3 GI:556503834
atgaaccatgcaccgcatttatatttcgcctggcaacaactcgtcgaaaaaagccagctc
atgttacgcctggcaacggaagaacaatgggacgaactcatcgccagcgaaatggcgtat
gtgaatgcggtgcaggagattgcacatttgactgaagaggttgacccgtccaccacgatg
caggagcagctccgcccgatgctgcgcctgattctcgacaacgaaagcaaggtaaagcag
ttattacagattcggatggatgaactggcgaaactggtcggtcagtcatcggtgcaaaaa
tcggtgttaagtgcctatggcgatcagggcggctttgtgctggctccgcaggataacctc
ttttga
              
                            

Download fasta file
RegulonDB