RegulonDB RegulonDB 11.0: Gene Sequence
dsbB gene sequence


Size: 531        A: 87  T: 164  G: 157  C: 123

Fasta

 

>dsbB E. coli K12. Version NC_000913.3 GI:556503834
atgttgcgatttttgaaccaatgttcacaaggccggggcgcgtggctgttgatggcgttt
actgctctggcactggaactgacggcgctgtggttccagcatgtgatgttactgaaacct
tgcgtgctctgtatttatgaacgctgcgcgttattcggcgttctgggtgctgcgctgatt
ggcgcgatcgccccgaaaactccgctgcgttatgtagcgatggttatctggttgtatagt
gcgttccgcggtgtgcagttaacttacgagcacaccatgcttcagctctatccttcgccg
tttgccacctgtgattttatggttcgtttcccggaatggctgccgctggataagtgggtg
ccgcaagtgtttgtcgcctctggcgattgcgccgagcgtcagtgggattttttaggtctg
gaaatgccgcagtggctgctcggtatttttatcgcttacctgattgtcgcagtgctggtg
gtgatttcccagccgtttaaagcgaaaaaacgtgatctgttcggtcgctaa
              
                            

Download fasta file
RegulonDB