RegulonDB RegulonDB 10.8: Gene Sequence
yhiD gene sequence


Size: 648        A: 172  T: 181  G: 171  C: 124

Fasta

 

>yhiD E. coli K12. Version NC_000913.3 GI:556503834
atgacagcagaatttattatacgtcttatactcgcggcaattgcctgtggcgctattggc
atggaaaggcaaatgcgcggcaaaggagcagggttacgcacacatgtattaattggcatg
ggaagcgccctgtttatgattgtttcgaaatatggttttgctgacgtgctgtctttagat
cacgtcggactcgaccccagccgtattgctgctcaggtggtgacgggcgtcgggtttatc
ggtgcaggtaacattctcgttcgtaaccaaaatattgtaggtctgacgacggcagcggat
atctgggtgaccgccgccataggtatggttattggcagcggtatgtacgaactgggtatt
tatggttcagtgatgaccttgttggtgctggaagtcttccatcaattaaccttccgcctg
atgaacaaaaattaccatttacagctgacattagtgaacggtaatacggtatcaatgctc
gactggtttaagcagcaaaaaataaaaactgatttagtttcgttgcaggaaaatgaagat
catgaagtggtcgccattgatatccagcttcatgccacaacgtcgatagaagacctgttg
cgattattaaaaggtatggcaggggtgaaaggcgtttcaattagctaa
              
                            

Download fasta file
RegulonDB