RegulonDB RegulonDB 10.9: Gene Sequence
treC gene sequence


Size: 1656        A: 404  T: 373  G: 450  C: 429

Fasta

 

>treC E. coli K12. Version NC_000913.3 GI:556503834
atgactcatcttccccactggtggcaaaacggcgttatctaccagatttatccaaagagt
tttcaggacaccacgggtagcggtaccggcgatttacgtggcgttatccaacacctggac
tatctgcataaactgggcgttgatgccatctggctaacccccttttatgtctctccccag
gtcgataacggttacgacgtagcgaactatacggcgattgatcccacctacggcacgctg
gacgattttgacgaactggtgacgcaggcaaaatcgcgcgggattcgtatcattctcgat
atggtgtttaaccatacctctacccaacatgcctggtttcgcgaggcgctgaacaaagaa
agcccttaccgccagttttatatctggcgcgatggagaaccagaaacgccaccgaacaac
tggcgttcaaaatttggcggtagtgcgtggcgctggcatgcggaaagcgaacagtactat
ttgcatctctttgcaccagaacaggcggatctcaactgggagaatccagcggtacgcgca
gagctgaaaaaagtctgtgagttctgggccgatcgtggggtcgacgggttgcgcctggat
gtggtgaatctgatctccaaagacccgcgtttccctgaagacctggacggcgacgggcgt
cgcttctacaccgacgggccacgagcacacgagtttttgcacgagatgaaccgcgatgtg
tttacgccacgcgggttaatgaccgtaggtgaaatgtcctccaccagccttgagcattgc
cagcgatacgcggctctgacaggcagtgaattgtcgatgacctttaattttcatcacctg
aaggtcgattatcccggtggtgaaaaatggacgctggctaaacctgactttgtggcgttg
aaaacattgttccgccactggcaacaaggaatgcacaacgtagcatggaatgccttgttc
tggtgtaaccacgatcagccgcgcattgtttctcgctttggtgatgaaggtgaataccgc
gtgcctgcggcaaaaatgctggcgatggtgctgcatggcatgcagggaacgccgtatatc
taccagggcgaagagattggcatgaccaacccgcatttcacgcgcattactgactatcgc
gacgtagagagcctcaatatgtttgccgagctgcgcaacgatgggcgtgatgccgacgag
ttattggcaatcctcgccagtaaatcccgtgacaacagtcgcacgcccatgcaatggagc
aacggcgataatgccgggtttacggctggcgaaccgtggattggcctgggcgataactat
caacaaatcaacgtagaagccgcgctggccgatgattcctcggtgttttacacctaccaa
aagttaatcgcactgcgtaagcaggaagccatcctgacatggggcaattaccaggatctg
ctgccaaacagccctgtattgtggtgctatcgccgtgaatggaaggggcaaaccttgctg
gtcattgccaaccttagccgtgagatccaaccctggcaggcagggcaaatgcgcggcaac
tggcagcttgtgatgcataactacgaagaagcctcaccacaaccctgtgccatgaattta
cggccttttgaggctgtctggtggttacagaagtaa
              
                            

Download fasta file
RegulonDB