RegulonDB RegulonDB 10.9: Gene Sequence
ppx gene sequence


Size: 1542        A: 387  T: 366  G: 419  C: 370

Fasta

 

>ppx E. coli K12. Version NC_000913.3 GI:556503834
atgccaatacacgataaatcccctcgtccgcaggagtttgctgcggtcgatcttggttca
aacagttttcacatggtcatagcccgtgtggtagatggtgccatgcagattattggccgc
ctgaaacagcgggtgcatctggcggacggcctggggccagataatatgttgagtgaagag
gcaatgacgcgcggtttaaactgtctgtcgctgtttgccgaacggctacaagggttttct
cctgccagcgtctgtatagttggtacccatacgctgcgtcaggcgctgaacgccactgac
tttctgaaacgcgcggaaaaggtcattccctacccgattgaaattatttccggtaatgaa
gaagcccgtctgatttttatgggcgtggaacatacccaaccggaaaaaggtcgcaaactg
gttattgatattggcggcggatctacggaactggtgattggtgaaaatttcgaacctatt
ctcgttgaaagccgccggatgggttgtgtcagctttgcccagctttattttcctggcggg
gtcatcaataaagagaattttcagcgcgctcgcatggcggcagcacaaaaactggaaact
ttaacctggcaattccgtattcagggctggaacgttgcaatgggcgcttccggtaccata
aaagccgcccatgaagtgttaatggaaatgggcgagaaagacgggataattaccccggaa
cgtctggaaaaactggtaaaagaagttttacgtcaccgtaatttcgcatcgctgagttta
ccgggtctttccgaagagcggaaaacagtcttcgttccgggactggcgattttatgcggt
gtgtttgatgctttagccatccgtgaactgcgcctttctgacggggcgttacgcgaaggc
gtactgtatgaaatggaaggacgtttccgtcatcaggatgtgcgtagtcgcaccgccagc
agcctcgccaaccagtatcacatcgacagcgaacaggcccgacgggtgctggataccact
atgcaaatgtacgaacagtggcgggaacagcaaccgaagctggcgcatccgcaactggag
gcgctactgcgatgggccgccatgctgcatgaggtcgggttgaatatcaaccacagcggt
ttgcatcgccactccgcttatattctgcaaaacagtgacttgccgggttttaatcaggaa
cagcagctgatgatggcgacactggtgcgctatcaccgtaaagcgattaagctcgacgat
ctaccgcgctttaccttgtttaagaagaaacagttcctgccactgatacagctattgcgc
cttggcgtattactcaacaatcaacgtcaggcaaccaccacaccgccaacattgacgctg
attactgatgacagtcactggacactgcgtttcccgcatgactggtttagtcagaatgcg
ctggtactgcttgatctggaaaaggagcaagaatactgggaaggcgtggctggctggcgg
ttgaaaattgaagaagaaagtacaccagaaatcgccgcttaa
              
                            

Download fasta file
RegulonDB