RegulonDB RegulonDB 10.9: Gene Sequence
ychF gene sequence


Size: 1092        A: 300  T: 235  G: 291  C: 266

Fasta

 

>ychF E. coli K12. Version NC_000913.3 GI:556503834
atgggattcaaatgcggtatcgtcggtttgcccaacgtcgggaaatctaccctgttcaac
gcgctgaccaaagccggtattgaagcggccaactttccattctgcaccattgagccgaac
acaggcgtcgtaccaatgcctgatcctcgcctggatcaactggctgaaatcgtaaaaccg
cagcgtacgcttcccacgaccatggaatttgtcgatatcgccggtctggtaaaaggcgca
tcgaaaggcgaaggtctgggtaaccagttcctgaccaacatccgtgaaaccgaagcgatc
ggtcacgttgttcgctgctttgaaaatgacaacatcattcacgtttccggcaaagttaac
ccggctgacgatattgaagttatcaacaccgaactggcgctggcagacctcgacacctgc
gaacgtgcgattcatcgcgtacagaagaaagccaaaggtggcgataaagacgcgaaagct
gagctggcggtcctggaaaaatgcctgccccagttggaaaatgcaggtatgctgcgcgcg
ctggatttaagcgctgaagagaaagcggctattcgttacctgagcttcctgacgctgaaa
ccaacaatgtacatcgccaacgtcaacgaagacggttttgaaaacaacccatatcttgac
caggtgcgtgaaatcgcggcgaaagaaggttctgttgtggttccggtttgtgctgctgtt
gaagcagacattgccgaactggacgacgaagaacgtgacgagtttatgcaggagcttggg
ctggaagagccgggcctgaaccgtgtgatccgtgccggttataaactgctgaacctgcaa
acttacttcaccgctggggtgaaagaagtgcgtgcatggaccattccggttggagcaacc
gcgccgcaggcagcgggcaaaatccatactgattttgaaaaaggctttatccgtgcacaa
accatctcgtttgaagatttcatcacttacaaaggtgaacaaggcgcgaaagaagcaggc
aaaatgcgtgcagaaggtaaagattacatcgtgaaagatggcgatgtgatgaacttcctt
ttcaacgtctaa
              
                            

Download fasta file
RegulonDB