RegulonDB RegulonDB 10.9: Gene Sequence
cydD gene sequence


Size: 1767        A: 358  T: 461  G: 493  C: 455

Fasta

 

>cydD E. coli K12. Version NC_000913.3 GI:556503834
atgaataaatctcgtcaaaaagagttaacccgctggttaaaacagcaaagcgtcatctcc
caacgttggctgaatatttctcgtctgctgggctttgtgagcggcatattgatcattgcc
caggcctggttcatggcgcgaattctgcaacatatgattatggagaatattccccgtgaa
gccctgctgcttccctttacgttactggttctgacctttgtactgcgcgcatgggtggtc
tggttacgcgaacgggtgggttatcacgccgggcagcatatccgctttgccatccgccgt
caggttctcgaccgtctgcaacaagcagggccagcgtggattcagggtaaacctgcgggg
agctgggcgacgctggtactcgagcaaattgacgatatgcatgattactatgcacgctat
ctgccgcaaatggcgctggcagtgtcggtgccgttgctgattgtggtggcaatcttcccc
tctaactgggctgcggcgctcattctgctgggcactgcaccgttaattccgttgtttatg
gcgctggttggaatgggggctgccgatgctaaccgacgtaactttctcgctcttgctcgc
ttaagtgggcatttcctcgatcgcctgcgcggcatggaaacattgcgtatttttggtcgt
ggtgaagctgaaattgaaagtattcgttctgcttcggaagatttccgccaacggacaatg
gaagtgctacggctggcgtttttatcctccggcattctcgaattttttacctcgctgtca
attgctctggtggcggtctactttggtttttcctatctcggcgagctggattttggtcac
tacgataccggtgtgacgctggctgcgggttttctggccctgatccttgcgccagagttt
ttccagccattacgcgatctcggtacgttttatcatgctaaagcccaggctgttggcgca
gctgacagtctgaaaacgtttatggaaaccccgctcgcccatccgcaacgtggtgaggcg
gaattagcatcgaccgatccggtgaccattgaggccgaggagctgtttatcacgtcgccg
gaaggtaaaacgctggccggaccgctgaactttactttgccagcaggccaacgtgcggtg
ttggttggtcgcagcggttcaggtaaaagctcactgctgaacgcgctttctggttttctc
tcatatcagggatcgctacgaatcaacgggatagaattacgcgatttatcaccagaatca
tggcgtaaacatctctcctgggttgggcaaaacccacaattaccggcagcaacattgcgg
gataacgtactactggcgcgacctgatgccagcgaacaagaattacaagcagcgctggat
aacgcctgggtcagcgagtttctaccgctcctcccacaaggcgttgatacgcctgttggc
gaccaggctgcccgcctttccgtggggcaggcgcagcgcgtggcggtggcccgtgcgtta
ctaaatccctgttcgctattactgttggatgaacccgctgccagccttgatgctcacagt
gaacagcgcgtaatggaggcgctgaatgccgcctctctgcgccagacaacgttaatggtc
acccaccagttagaagatcttgctgactgggatgtcatttgggttatgcaggatggccgg
attattgagcaaggacgttacgcggaattaagtgtggctggtggcccattcgccacatta
ctggcccatcgtcaggaggagatttaa
              
                            

Download fasta file
RegulonDB