RegulonDB RegulonDB 10.9: Gene Sequence
lpxK gene sequence


Size: 987        A: 199  T: 248  G: 308  C: 232

Fasta

 

>lpxK E. coli K12. Version NC_000913.3 GI:556503834
atgatcgaaaaaatctggtctggtgaatcccctttgtggcggctattgctgccactctcc
tggttgtatggcctggtgagtggcgcgatccgtctttgctataaactaaaactgaagcgc
gcctggcgtgcccccgtaccggttgtcgtggttggtaatctcaccgcaggcggcaacgga
aaaaccccggtcgttgtctggctggtggaacagttgcaacagcgcggtattcgcgtgggg
gtcgtatcgcggggatatggtggtaaggctgaatcttatccgctgttattgtcggcagat
accacaacagcacaggcgggtgatgaacctgtgttgatttatcaacgcactgatgcgcct
gttgcggtttctcccgttcgttctgatgcggtaaaagccattctggcgcaacaccctgat
gtgcagatcatcgtaaccgacgacggtttacagcattaccgtctggcgcgtgatgtggaa
attgtcgttattgatggtgtgcgtcgctttggcaatggctggtggttgccggcggggcca
atgcgtgagcgagcggggcgcttaaagtcggttgatgcggtaatcgtcaacggcggtgtc
cctcgcagcggtgaaatccccatgcatctgctgccgggtcaggcggtgaatttacgtacc
ggtacgcgttgtgacgttgctcagcttgaacatgtagtggcgatggcggggattgggcat
ccgccgcgcttttttgccacgctgaagatgtgtggcgtacaaccggaaaaatgtgtaccg
ctggccgatcatcagtctttgaaccatgcggatgtcagtgcgttggtaagcgccgggcaa
acgctggtaatgactgaaaaagatgcggtgaaatgccgggcctttgcagaagaaaattgg
tggtatttgcctgtagacgcacagctttcaggtgatgaaccagcgaaactgcttacgcaa
ctaaccttgctggcttctggcaactag
              
                            

Download fasta file
RegulonDB