RegulonDB RegulonDB 10.8: Gene Sequence
dps gene sequence


Size: 504        A: 146  T: 111  G: 117  C: 130

Fasta

 

>dps E. coli K12. Version NC_000913.3 GI:556503834
atgagtaccgctaaattagttaaatcaaaagcgaccaatctgctttatacccgcaacgat
gtctccgacagcgagaaaaaagcaacagtagagttgctgaatcgccaggttatccagttt
attgatctttctttgattaccaaacaagcgcactggaacatgcgcggcgctaacttcatt
gccgtacatgaaatgctggatggcttccgcaccgcactgatcgatcatctggataccatg
gcagaacgtgcagtgcagctgggcggtgtagctctggggaccactcaagttatcaacagc
aaaaccccgctgaaaagttacccgctggacatccacaacgttcaggatcacctgaaagaa
ctggctgaccgttacgcaatcgtcgctaatgacgtacgcaaagcgattggcgaagcgaaa
gatgacgacaccgcagatatcctgaccgccgcgtctcgcgacctggataaattcctgtgg
tttatcgagtctaacatcgaataa
              
                            

Download fasta file
RegulonDB