RegulonDB RegulonDB 10.9: Gene Sequence
dcd gene sequence


Size: 582        A: 106  T: 125  G: 194  C: 157

Fasta

 

>dcd E. coli K12. Version NC_000913.3 GI:556503834
atgcgtctgtgtgaccgagatattgaagcctggcttgatgaaggccgtttgtcgatcaac
ccacgtccgccagtggagcgtattaacggcgcgacggtggatgtacgcctgggcaataaa
tttcgtaccttccgtggtcacacggcagcgtttatcgatctgagcggtcccaaagatgaa
gtgagcgccgcgcttgaccgcgtgatgagcgatgagatcgttctcgacgagggcgaggcg
ttctatcttcacccaggagagctggcgctggcggtgacgctggagtcggtgacgctgcca
gccgatctggtgggctggctggacgggcgttcctcactggcgcgtctggggctgatggtg
cacgtcaccgcgcaccgcatcgatccgggctggtctggttgcattgtgctggagttctac
aactccggtaagctgccgctggcgctgcgtccgggcatgttaattggtgcgctgagcttt
gagccgctttccggcccggcggtgcgaccttacaaccgccgtgaagatgcgaaatatcgc
aaccagcagggcgcggtagccagccgaatcgataaagactaa
              
                            

Download fasta file
RegulonDB