RegulonDB RegulonDB 10.8: Gene Sequence
cynR gene sequence


Size: 900        A: 195  T: 210  G: 256  C: 239

Fasta

 

>cynR E. coli K12. Version NC_000913.3 GI:556503834
atgctctctcgacatatcaattattttcttgccgtggctgaacatggcagcttcacccgt
gccgccagtgcgttgcacgtctcccaacctgcgctttcccagcagattcgccagttagag
gagagtttaggcgtgccgctgtttgaccgtagcgggcgaacgattcgtctcactgatgca
ggagaagtctggcgacagtacgccagccgggcgttacaggaactgggggcgggtaaacgg
gcgattcatgatgttgccgatctgacgcgaggatcgctgcgtatcgccgtcacccccacc
tttacgagctactttatcggccccttaatggcggatttctatgcgcgctatcccagcatc
acgctccagctacaggaaatgtcgcaggagaaaatcgaggatatgctttgccgcgacgag
ttggacgttgggattgccttcgcgcctgtgcattcgccggagctggaggcaattccttta
ctgacagaaagtttagcgttagtcgtggcgcaacatcatccgctggccgtccatgaacag
gtggcgttgagtcgcttgcatgatgaaaaactggtcctgctcagcgcggaatttgccacc
agagagcaaattgaccactactgcgagaaagcggggctacatccacaggtggtcattgag
gcgaactcaattagcgcggttctggagctgattcgccgcacttccctttccacattgtta
ccagcagcgattgccacacaacatgacgggcttaaagctatttctcttgccccgccacta
ctggagagaacggcggttttgttgcggcggaaaaatagctggcagacagccgccgcgaag
gcatttttgcacatggcgttggataaatgcgcggttgttggcggaaatgaatcacggtag
              
                            

Download fasta file
RegulonDB