RegulonDB RegulonDB 10.9: Gene Sequence
inaA gene sequence


Size: 651        A: 172  T: 157  G: 190  C: 132

Fasta

 

>inaA E. coli K12. Version NC_000913.3 GI:556503834
atggcagtttcagcaaagtacgacgaatttaatcactggtgggcaacagagggcgactgg
gttgaagagcctaactatcgccgtaatggtatgagcggggtgcaatgcgtcgagcgcaac
ggcaaaaagctgtatgtaaagcgcatgacgcatcatctgtttcattccgtacgttatccg
ttcggccgaccaacgattgtccgtgaggttgcggtaattaaagaactggaacgggccggt
gtcatcgtgccgaagatcgtttttggtgaagcggtgaaaattgagggtgaatggcgagcg
ttgctggtgactgaagatatggcggggttcatcagcattgctgactggtatgcccagcat
gcagtatcgccttattctgacgaagtacggcaagccatgttgaaagcagtggcgctggcg
tttaagaaaatgcatagcattaatcgtcagcatggctgttgttatgttcgccatatctat
gtgaaaacagaaggtaatgcagaagctggttttcttgacctggagaaaagtcgtcgccgc
ttgcgtcgcgataaagcgattaatcatgacttccgccagctggaaaaatatctggagcca
atccccaaagcggactgggagcaggtgaaagcgtattactacgccatgtaa
              
                            

Download fasta file
RegulonDB