RegulonDB RegulonDB 10.9: Gene Sequence
waaY gene sequence


Size: 699        A: 229  T: 223  G: 134  C: 113

Fasta

 

>waaY E. coli K12. Version NC_000913.3 GI:556503834
atgattcagaagagcaagatcaaagacttggttgtttttaccgatgaaaacaattcaaag
tacctcaatgtattaaatgacttcttgtcttataatataaatatcatcaaggtttttcgt
tctattgatgatacaaaagttatgcttattgataccgattacggtaaattgattcttaag
gttttttctccgaaagttaagcgtaacgaacgtttctttaagtctctgttaaaaggtgat
tattacgaacgcctttttgagcaaacccaaaaagtacgaaatgaagggttaaatacactc
aatgacttttatttattggctgaacggaaaaccttacgttttgtccatacttatatcatg
atcatcgagtatattgatggcatagagttgtgtgatatgcccgatattgatgatgcgcta
aaaaataaaattcagcaatcaattaatgccttacatcaacatggcatggtttctggcgac
ccccatcgtggtaacttcattataaaaaatggtgaggttcgaattatcgatctctccgga
aagcgtgcttcagcgcagcgtaaagcgaaagatcgtattgacttagagcgtcattacggt
attaaaaatgagattagagatctaggctattatcttttagtatatcgtaaaaaaatgcgc
aattttatgcggcgtttgaaagggaaaccagcgcgctaa
              
                            

Download fasta file
RegulonDB