RegulonDB RegulonDB 10.9: Gene Sequence
waaZ gene sequence


Size: 852        A: 281  T: 294  G: 143  C: 134

Fasta

 

>waaZ E. coli K12. Version NC_000913.3 GI:556503834
atgaagaatattagatacattgacaaaaaagatgttgaaaacctgattgaaaataaaata
tctgatgatgttattatttttctttcgggccctacatcgcaaaaaacacctttgtcagta
ttacgaacaaaggatattattgctgtcaatggttctgcgcaatatctgttaagtaataat
atcgttccttttatatatgtacttacagatgtccgatttttacatcagcgtcgtgatgat
ttttataaatttagccagagaagtcgttataccatagtaaacgttgacgtttatgaacac
gcttccaaagaagataaactttatatcctccagaactgcctcgtattacggtccttttac
cgtcgggaaaaaggtggttttataaagaagattaaatttaatattttgagacagattcac
aaagaactgctgatctctgtaccgttgtctaaaaaaggtcgtctggttggattttgcaag
gacattagtcttggttattgctcatgccatactattgcctttgctgcaattcaaatcgca
tattcacttaagtatgcgcggattatttgttctggtcttgatttaacgggtagctgttct
cgtttctatgatgagaataaaaatcccatgccctcggaattaagtagggatttattcaaa
atattgccattttttcgttttatgcatgataatgtaaaagatattaatatttataattta
tcagatgatacagctatttcttacgatgtaattccatttattaaacttcaagacatcagt
gcagaagaatcaaaagatatgacaagaaaaaaaatgcaatatagaacttcaaccgattct
tatgctaattaa
              
                            

Download fasta file
RegulonDB