RegulonDB RegulonDB 10.10: Gene Sequence
roxA gene sequence


Size: 1122        A: 254  T: 262  G: 319  C: 287

Fasta

 

>roxA E. coli K12. Version NC_000913.3 GI:556503834
atggaataccaactcactcttaactggcccgattttcttgaacgtcactggcagaaacgc
ccggtggtgttaaaacgcggctttaataattttattgacccgatctctccagacgagttg
gcgggtctggcgatggaaagcgaagttgacagtcgactggtcagtcaccaggatggcaaa
tggcaggtcagccacggcccgttcgaaagctacgatcatctcggtgaaaccaactggtca
ttactggtacaggcagtgaaccactggcatgagccgaccgccgcgctgatgcgaccgttc
cgtgaactaccggactggcgtattgatgatctgatgatttctttttctgtacccggcggc
ggcgtcggcccgcatctcgatcagtacgacgtgtttatcattcagggtaccggacgtcgt
cgctggcgagtgggcgaaaagctgcaaatgaaacagcactgcccacatccggatctgtta
caggtcgatccgttcgaagccatcatcgatgaagagctggagcctggtgatattctttat
attccgccaggattcccgcatgaaggctacgcgctggaaaatgcgatgaactattccgtg
ggctttcgcgcgccaaatacgcgggaactgattagtggatttgccgattatgtgctgcaa
cgtgaactgggcggcaactactacagcgatccggatgttccacctcgcgctcatcctgcg
gatgttctgccgcaagagatggataaactgcgtgagatgatgctcgaattgatcaaccag
ccggaacactttaagcaatggtttggcgagtttatatcccagtcacgtcatgaactggat
atcgcgccgccagagccgccttatcagccggatgaaatctacgatgcgctgaaacaaggt
gaagtgctggtgcgcctgggtggtctgcgcgtattgcgcattggcgacgacgtgtatgcc
aatggtgagaagatcgattccccgcaccgtccggcactggatgcactcgccagcaacatt
gcgctgactgcggagaattttggcgatgcgctggaagatccgtcattcctcgcgatgctc
gcggcgctggtcaatagcgggtattggttcttcgaagggtaa
              
                            

Download fasta file
RegulonDB