RegulonDB RegulonDB 10.8: Gene Sequence
yfeC gene sequence


Size: 345        A: 99  T: 73  G: 94  C: 79

Fasta

 

>yfeC E. coli K12. Version NC_000913.3 GI:556503834
atgacaccagatgaacttgccagactgaccggctatagccgccagaccattaataaatgg
gtacgcaaggaaggctggacaacgtcaccaaaacctggcgtccagggtggcaaagcccga
ctggttcacgtcaatgaacaggttcgtgaatatattcgcaatgctgaacgtccagaaggt
cagggagaagcgcctgccctttctggtgatgcgccgcttgaagtattgctggtgacactg
gcgaaagagatgacgccagttgaacaaaaacagtttacatccttgcttctgcgggaaggg
attatcggattgttacaacgcttagggattcgcgatagcaaataa
              
                            

Download fasta file
RegulonDB