RegulonDB RegulonDB 10.9: Gene Sequence
marR gene sequence


Size: 435        A: 117  T: 103  G: 115  C: 100

Fasta

 

>marR E. coli K12. Version NC_000913.3 GI:556503834
gtgaaaagtaccagcgatctgttcaatgaaattattccattgggtcgcttaatccatatg
gttaatcagaagaaagatcgcctgcttaacgagtatctgtctccgctggatattaccgcg
gcacagtttaaggtgctctgctctatccgctgcgcggcgtgtattactccggttgaactg
aaaaaggtattgtcggtcgacctgggagcactgacccgtatgctggatcgcctggtctgt
aaaggctgggtggaaaggttgccgaacccgaatgacaagcgcggcgtactggtaaaactt
accaccggcggcgcggcaatatgtgaacaatgccatcaattagttggccaggacctgcac
caagaattaacaaaaaacctgacggcggacgaagtggcaacacttgagtatttgcttaag
aaagtcctgccgtaa
              
                            

Download fasta file
RegulonDB