RegulonDB RegulonDB 10.9: Gene Sequence
plsX gene sequence


Size: 1071        A: 250  T: 263  G: 309  C: 249

Fasta

 

>plsX E. coli K12. Version NC_000913.3 GI:556503834
ttgacacgtctaaccctggcgttagatgtcatgggaggggattttggcccttccgtgaca
gtgcctgcagcattgcaggcactgaattctaattcgcaactcactcttcttttagtcggc
aattccgacgccatcacgccattacttgctaaagctgactttgaacaacgttcgcgtctg
cagattattcctgcgcagtcagttatcgccagtgatgcccggccttcgcaagctatccgc
gccagtcgtgggagttcaatgcgcgtggccctggagctggtgaaagaaggtcgagcgcaa
gcctgtgtcagtgccggtaataccggggcgctgatggggctggcaaaattattactcaag
cccctggaggggattgagcgtccggcgctggtgacggtattaccacatcagcaaaagggc
aaaacggtggtccttgacttaggggccaacgtcgattgtgacagcacaatgctggtgcaa
tttgccattatgggctcagttctggctgaagaggtggtggaaattcccaatcctcgcgtg
gcgttgctcaatattggtgaagaagaagtaaagggtctcgacagtattcgggatgcctca
gcggtgcttaaaacaatcccttctatcaattatatcggctatcttgaagccaatgagttg
ttaactggcaagacagatgtgctggtttgtgacggctttacaggaaatgtcacattaaag
acgatggaaggtgttgtcaggatgttcctttctctgctgaaatctcagggtgaagggaaa
aaacggtcgtggtggctactgttattaaagcgttggctacaaaagagcctgacgaggcga
ttcagtcacctcaaccccgaccagtataacggcgcctgtctgttaggattgcgcggcacg
gtgataaaaagtcatggtgcagccaatcagcgagcttttgcggtcgcgattgaacaggca
gtgcaggcggtgcagcgacaagttcctcagcgaattgccgctcgcctggaatctgtatac
ccagctggttttgagctgctggacggtggcaaaagcggaactctgcggtag
              
                            

Download fasta file
RegulonDB