RegulonDB RegulonDB 10.9: Gene Sequence
rpiA gene sequence


Size: 660        A: 166  T: 152  G: 187  C: 155

Fasta

 

>rpiA E. coli K12. Version NC_000913.3 GI:556503834
atgacgcaggatgaattgaaaaaagcagtaggatgggcggcacttcagtatgttcagccc
ggcaccattgttggtgtaggtacaggttccaccgccgcacactttattgacgcgctcggt
acaatgaaaggccagattgaaggggccgtttccagttcagatgcttccactgaaaaactg
aaaagcctcggcattcacgtttttgatctcaacgaagtcgacagccttggcatctacgtt
gatggcgcagatgaaatcaacggccacatgcaaatgatcaaaggcggcggcgcggcgctg
acccgtgaaaaaatcattgcttcggttgcagaaaaatttatctgtattgcagacgcttcc
aagcaggttgatattctgggtaaattcccgctgccagtagaagttatcccgatggcacgt
agtgcagtggcgcgtcagctggtgaaactgggcggtcgtccggaataccgtcagggcgtg
gtgaccgataatggcaacgtgatcctcgacgtccacggcatggaaatccttgacccgata
gcgatggaaaacgccataaatgcgattcctggcgtggtgactgttggcttgtttgctaac
cgtggcgcggacgttgcgctgattggcacacctgacggtgtcaaaaccattgtgaaatga
              
                            

Download fasta file
RegulonDB