RegulonDB RegulonDB 10.9: Gene Sequence
csrA gene sequence


Size: 186        A: 49  T: 45  G: 52  C: 40

Fasta

 

>csrA E. coli K12. Version NC_000913.3 GI:556503834
atgctgattctgactcgtcgagttggtgagaccctcatgattggggatgaggtcaccgtg
acagttttaggggtaaagggcaaccaggtacgtattggcgtaaatgccccgaaggaagtt
tctgttcaccgtgaagagatctaccagcgtatccaggctgaaaaatcccagcagtccagt
tactaa
              
                            

Download fasta file
RegulonDB