RegulonDB RegulonDB 10.9: Gene Sequence
rffG gene sequence


Size: 1068        A: 253  T: 241  G: 305  C: 269

Fasta

 

>rffG E. coli K12. Version NC_000913.3 GI:556503834
atgagaaaaattctgataacaggtggtgccgggtttattggctcggcgctggtgcgttat
atcatcaacgaaacgagcgacgcggtggtagtggtcgataagctgacctacgccggaaac
ctgatgtcgctggcaccggtcgcgcaaagcgagcgctttgcctttgagaaagttgatatc
tgcgatcgggcagaactggcacgcgtattcactgagcatcagccagactgtgtcatgcat
ctggcagccgaaagccatgttgaccgttctattgacggcccggcagcgtttattgaaacc
aacattgtcgggacttatacattgcttgaagcggcgcgggcttactggaatgcgctgacg
gaagataaaaaatcagcgttccgttttcatcatatctccactgacgaagtatatggtgac
ctgcactcgacggatgatttcttcaccgaaaccacgccgtatgcgccgagcagcccttat
tccgcgtcaaaagccagcagcgaccatctggtgcgcgcctggctgcggacctatggtctg
ccgacgcttatcaccaactgctcgaataactacggcccttaccactttccggaaaaactg
atcccgctgatgatcctcaacgcgctggcgggtaaatcgctgccggtatatggcaacggg
cagcaaatccgtgactggctgtatgtggaagatcacgcccgcgcgctgtattgcgtggcg
accaccgggaaagtcggtgaaacctataatattggtggtcacaacgagcgtaagaatctc
gatgttgtggaaaccatttgcgagctgctggaagaactggctccgaacaagccgcacggc
gtggcgcactatcgtgacctgatcacctttgtcgctgaccgtccggggcatgatctgcgt
tatgccattgatgcttcgaaaattgcccgtgaacttggctggctgccgcaggaaaccttt
gaaagtggaatgcgtaaaacggttcagtggtatctggctaatgaaagctggtggaagcag
gtgcaggacggcagctatcagggcgagcgtttaggtctgaaaggctaa
              
                            

Download fasta file
RegulonDB