RegulonDB RegulonDB 10.9: Gene Sequence
narQ gene sequence


Size: 1701        A: 404  T: 419  G: 450  C: 428

Fasta

 

>narQ E. coli K12. Version NC_000913.3 GI:556503834
gtgattgttaaacgacccgtctcggccagtctggcccgggcctttttttacattgtgctg
ctgtcgattctttccacgggtatcgctctgctaactctggcgagcagtttgcgcgacgct
gaggctatcaatattgccggatcgctgcgtatgcagagttaccgcctgggctacgacttg
caaagtggcagtccacaactcaatgcacatcgccagttatttcagcaggcactgcattca
ccggtattaaccaacctcaacgtctggtatgtgccagaagcagtaaaaactcgctatgcg
catctgaatgccaactggctggagatgaataatcggctcagcaagggcgatttgccgtgg
tatcaggccaatattaataattatgttaatcagatagacctgttcgtactggctttacag
cactacgctgaacgcaaaatgctgctggtggtggcgatttccctggctggcggcatcggt
attttcacgctggtcttttttactttgcgccgcatacgccatcaggtggttgccccgctg
aatcagctggttaccgccagtcagcgtattgaacacgggcagttcgactcgccgccgctg
gataccaacctgccgaatgagcttggtctgcttgcaaaaacctttaaccagatgtcgagc
gagctgcataaattgtaccgttcgctggaagcgtcagtagaagaaaagacccgcgatctc
cacgaggccaagcgtcgtctggaggtgttgtatcagtgttcgcaggcgctgaacactagc
cagattgatgtgcattgtttccgccatattttgcagattgttcgcgacaatgaagcggct
gaatatctggagttaaatgtcggtgaaaactggcggattagcgaagggcaaccaaacccg
gaattgccgatgcagattttaccggtgacaatgcaagagacggtttacggcgaactgcac
tggcaaaatagtcacgtttcatcatcagaaccgctgcttaacagcgtttcgtcgatgctg
ggacgcggtttgtactttaatcaggcgcagaagcattttcagcaattattgttgatggaa
gaacgtgcgaccatcgcccgcgaattgcacgactcgctggctcaggtactttcttactta
cgtatccagttgacgttactgaagcgttcgataccggaagataacgccaccgcacaaagt
atcatggccgatttttcccaggcgttgaatgatgcttatcggcagttacgcgagctgttg
actactttccgcctgacgctgcagcaggcggatctcccctccgcattgagggaaatgctg
gatacgttacaaaatcaaaccagcgccaaactgaccctcgactgccgtctgccaaccctg
gcactggatgcgcaaatgcaggtgcatttgttgcaaattattcgcgaagcggtgctgaat
gcgatgaagcacgccaacgccagcgaaatcgccgtcagttgcgtcaccgcgccggacggc
aatcacacggtttatatccgtgataacgggattggtatcggtgaaccgaaagaacccgaa
ggtcattatggtctgaatatcatgcgcgaacgcgcggaacggctaggtgggacgctgact
ttttcacaaccttccggcggcggcacgttagtgagtattagctttcgctctgcggagggt
gaggaaagtcagttaatgtaa
              
                            

Download fasta file
RegulonDB