RegulonDB RegulonDB 10.10: Gene Sequence
yigF gene sequence


Size: 381        A: 121  T: 127  G: 79  C: 54

Fasta

 

>yigF E. coli K12. Version NC_000913.3 GI:556503834
atgagtaaggaatatatgaacgatggttcattaagtgaaaaatggaaataccgatttaat
ttttatgatcaacatggttttcctggattctggggggcaacaccagaatataaagcagca
tttaaagcattaaaagtaagacaacgcttaactattcaaatgaatttcattgctttcttc
tgttcctggatatatttatttgtcctggggttatggaaaaaagcaattatagttctatta
cttggtattctatctctatttgttggtgcactaattggcgttaacattctgggaattgcc
gtagcagcctatgttgctgttaacacgaacaaatggttctatgagaaagaggtaaaaggg
ttaaatacctggagcctttga
              
                            

Download fasta file
RegulonDB