RegulonDB RegulonDB 10.10: Gene Sequence
yigG gene sequence


Size: 381        A: 102  T: 154  G: 54  C: 71

Fasta

 

>yigG E. coli K12. Version NC_000913.3 GI:556503834
atgttacgtatatttatcccaacatctaacggtaagatttccagacgtcgttatatattt
tcatttattttaataaatttcatttttgcctttcttattatcttttttaacgatggagaa
gcaggctttcttgttatagtctctaccatcgtactccattatctcgtcatcaacatgaat
tgccagcgactccgtgatagtggtttcatctatataaaaacttatgtttttggtacatta
gcagtatatatcatctctatcatcacaatgatagccgaagattttgcctgttcaggcaat
ggttcgatgatttttttgatttgttatttttccactttcagtatgctaatgcttgcacct
actgattcatcaaaacaatag
              
                            

Download fasta file
RegulonDB