RegulonDB RegulonDB 10.9: Gene Sequence
rarD gene sequence


Size: 891        A: 175  T: 265  G: 242  C: 209

Fasta

 

>rarD E. coli K12. Version NC_000913.3 GI:556503834
atggatgcaaaacaaacgcggcagggcgtattactcgctcttgccgcttattttatttgg
ggtatagcgccagcgtacttcaagttgatttactacgtgcccgccgatgaaatcctgacg
catcgcgtgatctggtcgtttttctttatggtggtgctgatgagcatttgccgccagtgg
tcctatttaaaaacgctgattcagacgccacagaaaatttttatgctggcagtctctgcc
gtgctgattggtggcaactggctactgtttatctgggcggtgaacaatcaccatatgctg
gaagcgagccttggttactttattaacccgctggtgaacattgtgctggggatgattttc
ctcggcgagcgattccgccggatgcaatggctggcggtgattctggcgatatgtggcgtg
ttagtccagctgtggacttttggttcgctacctattatcgcgctgggactggcatttagt
tttgccttctacggtctggtacgcaagaagattgccgttgaagcgcaaaccggcatgtta
atcgaaaccatgtggctgctgcccgtggcggcaatttacctgtttgctattgccgacagc
tcaaccagccatatggggcaaaacccgatgtcgctgaatttactgctgatcgccgccggt
attgtcactaccgtaccgctgttgtgttttaccgccgctgccacgcgcttgcgtctctca
acgttaggctttttccagtacattggcccgacgctgatgttcctgctggctgtgacgttt
tatggtgaaaaaccgggtgccgataagatggtgactttcgcctttatttgggtggcgctg
gcaatttttgtgatggatgcgatttatacgcagcgtagaacgtccaaataa
              
                            

Download fasta file
RegulonDB