RegulonDB RegulonDB 10.10: Gene Sequence
gadB gene sequence


Size: 1401        A: 330  T: 324  G: 376  C: 371

Fasta

 

>gadB E. coli K12. Version NC_000913.3 GI:556503834
atggataagaagcaagtaacggatttaaggtcggaactactcgattcacgttttggtgcg
aagtctatttccactatcgcagaatcaaaacgttttccgctgcacgaaatgcgcgacgat
gtcgcattccagattatcaatgacgaattatatcttgatggcaacgctcgtcagaacctg
gccactttctgccagacctgggacgacgaaaatgtccacaaattgatggatttatccatt
aacaaaaactggatcgacaaagaagaatatccgcaatccgcagccatcgacctgcgttgc
gtaaatatggttgccgatctgtggcatgcgcctgcgccgaaaaatggtcaggccgttggc
accaacaccattggttcttccgaggcctgtatgctcggcgggatggcgatgaaatggcgt
tggcgcaagcgtatggaagctgcaggcaaaccaacggataaaccaaacctggtgtgcggt
ccggtacaaatctgctggcataaattcgcccgctactgggatgtggagctgcgtgagatc
cctatgcgccccggtcagttgtttatggacccgaaacgcatgattgaagcctgtgacgaa
aacaccatcggcgtggtgccgactttcggcgtgacctacactggtaactatgagttccca
caaccgctgcacgatgcgctggataaattccaggccgataccggtatcgacatcgacatg
cacatcgacgctgccagcggtggcttcctggcaccgttcgtcgccccggatatcgtctgg
gacttccgcctgccgcgtgtgaaatcgatcagtgcttcaggccataaattcggtctggct
ccgctgggctgcggctgggttatctggcgtgacgaagaagcgctgccgcaggaactggtg
ttcaacgttgactacctgggtggtcaaattggtacttttgccatcaacttctcccgcccg
gcgggtcaggtaattgcacagtactatgaattcctgcgcctcggtcgtgaaggctatacc
aaagtacagaacgcctcttaccaggttgccgcttatctggcggatgaaatcgccaaactg
gggccgtatgagttcatctgtacgggtcgcccggacgaaggcatcccggcggtttgcttc
aaactgaaagatggtgaagatccgggatacaccctgtatgacctctctgaacgtctgcgt
ctgcgcggctggcaggttccggccttcactctcggcggtgaagccaccgacatcgtggtg
atgcgcattatgtgtcgtcgcggcttcgaaatggactttgctgaactgttgctggaagac
tacaaagcctccctgaaatatctcagcgatcacccgaaactgcagggtattgcccaacag
aacagctttaaacatacctga
              
                            

Download fasta file
RegulonDB