RegulonDB RegulonDB 10.9: Gene Sequence
prfH gene sequence


Size: 501        A: 121  T: 108  G: 152  C: 120

Fasta

 

>prfH E. coli K12. Version NC_000913.3 GI:556503834
gtgctggaaacagaaacgggccgctactctgacacactgcgttcggcgctggtttctctc
gatggcgataacgcatgggcattaagcgaaagctggtgtggcactattcagtggatttgt
ccgagtccgtatcggcctcatcatgggcgcaaaaactggtttctgggcattgggcgtttt
accgctgatgagcaggaacaatcggatgcaatccgttatgagacgctgcgttcgtcgggg
ccgggcggtcaacatgtcaataaaaccgactcggcggtacgcgccacgcatttggcatcc
ggtattagcgtgaaggttcagtcagagcgtagtcagcatgctaacaagcggctggcacga
ttgctgattgcctggaagctggagcaacagcaacaggaaaatagcgcggcgctgaaatcg
cagcggcgaatgttccatcaccagattgaacgtggcaacccgcgacggacatttacaggg
atggcttttatcgaaggataa
              
                            

Download fasta file
RegulonDB